# Houten Schaal — Stoutenburger Almanac

## Card

- **Number:** SBA-013
- **Name:** Houten Schaal
- **World:** SBA
- **Type:** product
- **Language:** nl
- **ULID:** 01KJCHJ21C1RABE3P2ZJASVY4C
- **DNA:** aatgaccagtctaatgtaagtttagcccgctcttgagataaaacgctagcgcacgcaagaagta
- **Version:** d05f6e45 (2026-09-17)
- **Verify:** https://stoutenburger.com/verify/?dna=aatgaccagtctaatgtaagtttagcccgctcttgagataaaacgctagcgcacgcaagaagta&v=d05f6e45

## Front

*Turned Bowl*

Uit één stuk gedraaid, de nerf loopt door tot in de rand. Een schaal die dagelijks gebruik verdraagt.

## Content

### Material

wood

### Cartouche

- **variant:** wood

## Body

## What it is

A traditional carpenter's mallet, turned on a pole lathe from a single piece of green beech. The head and handle are one continuous grain — nothing laminated, nothing bolted. When it dries, the wood tightens around its own geometry.

This is the tool you reach for when a steel hammer would split the work. Chisel strikes. Dowel seating. Joint persuasion. Anywhere you need force without destruction.

## How it is made

The blank is split from a fresh beech log, never sawn. Splitting follows the grain, which means the fibers run unbroken from handle to striking face. The piece is mounted between centers on a spring-pole lathe and turned while still green — wet wood cuts cleaner and faster.

The head is left intentionally oversized. As the wood dries over several weeks, it shrinks and hardens. The final dimensions emerge from the material, not from a plan.

No finish is applied. Beech develops its own patina through use — the oils from your hands and the dust from your work become the surface.

## Specifications

- **Material**: European beech (*Fagus sylvatica*), green-split
- **Head diameter**: approximately 90 mm (varies per piece)
- **Overall length**: approximately 300 mm
- **Weight**: 400–500 g (dry)
- **Finish**: none — raw wood, hand-burnished

## Why this matters

A mallet is one of the first tools any woodworker needs, and one of the first things you can make with nothing but a knife and a lathe you built yourself. This product exists as proof: useful things can come from local wood, simple tools, and patience.

If the supply chain breaks, beech still grows. And this mallet still works.

## Relations

- tp:woodworking: topic
- tp:craft: topic
- [Stoutenburger](https://stoutenburger.com/stoutenburger-agttttacgaagacccaggttgactaaagtcgcatcagaaaaacgctgtggcagacgacagcca/card.md): authored by
- [Stoutenburger Almanac](https://stoutenburger.com/): world
- [image](https://stoutenburger.com/hand-carved-wooden-mallet-aatgaccagtctaatgtaagtttagcccgctcttgagataaaacgctagcgcacgcaagaagta/assets/cards/sb-hout-schaal.webp): card illustration

## Source

- **Canonical:** https://stoutenburger.com/hand-carved-wooden-mallet-aatgaccagtctaatgtaagtttagcccgctcttgagataaaacgctagcgcacgcaagaagta/
- **Maker:** [Stoutenburger](https://stoutenburger.com/stoutenburger-agttttacgaagacccaggttgactaaagtcgcatcagaaaaacgctgtggcagacgacagcca/card.md)

The canonical HTML page and card.json are the authoritative representations.
