Klik en Flip

Stoutenburger Almanac

Stoutenburger
Almanac

Rebuilding The World
Edition 1
✦
„Kennis die alleen op een scherm bestaat, is geleend." — Eo Ena · Archivaris
I · marsh · ridge · plum dna:tggagatctgaattacatggggcatcgctcggtgtctgtcaaacgcttcgccaactccgttcct RTW-005
Edition 1Stoutenburger AlmanacTurn ↻

Vuur maken

Achterzijde

RTW-005 Edition 1
Edition 1Stoutenburger AlmanacTurn ↻

Vuur maken

Making Fire From What You Find

RTW-005 Edition 1
Instructie I · Owl · Blue · Grain Basic 8 stappen · ± 2 uur oefenen
Vuur maken
Eo Ena
Acht stappen tussen jou en een vlam. Werk droog, werk op volgorde — ik lees met je mee. — Eo Ena · Archivaris
Edition 1Stoutenburger AlmanacTurn ↻

Vuur maken

Achterzijde

RTW-005 Edition 1
Edition 1Stoutenburger AlmanacTurn ↻

Vuur maken

Making Fire From What You Find

RTW-005 Edition 1
Instructie I · Plum · Brook · Lamp Basic Benodigdheden

Materialen

Tindercompletely dry, fine material that catches a spark or ember: dry grass, birch bark shavings, charcloth, cattail fluff, shredded dry inner bark (cedar, lime, willow), fine wood shavings, dry fungus (e.g. Fomes fomentarius) Bestel ↗ Kindlingthin, dry sticks (pencil-thickness), dry bark strips, small split wood pieces Bestel ↗ Fuel woodprogressively thicker dry sticks and split logs, starting finger-thick up to wrist-thick Bestel ↗ Fireboardfor friction fire: a flat piece of dry softwood (willow, poplar, lime, cedar) Bestel ↗ Spindlefor friction fire: a straight, dry hardwood stick, roughly 30-50cm long, thumb-thick Bestel ↗ Bowfor bow drill: a curved stick (arm length), with cordage (shoelace, plant fiber rope, rawhide strip) Bestel ↗ Handholdfor bow drill: a hard piece of wood, stone, or shell with a depression to hold the top of the spindle Bestel ↗ Rocksfor flint and steel: hard, sharp stone (flint, chert, quartzite, obsidian) and a piece of high-carbon steel or iron pyrite Bestel ↗

Handig, niet nodig

Knifefor preparing tinder and kindling, carving notches Bestel ↗ Charclothpre-made char catches sparks far more reliably than natural tinder (made by heating cotton cloth in a sealed tin over a fire) Bestel ↗ Petroleum jelly cotton ballsextremely reliable tinder if available (pre-crisis preparation) Bestel ↗

Bestellen via deze verwijzingen steunt de Almanac — de prijs blijft gelijk.

Edition 1Stoutenburger AlmanacTurn ↻

Vuur maken

Achterzijde

RTW-005 Edition 1

Veiligheid

Burns — Fire is hot. Clear the area around your fire. Never leave a fire unattended. Keep water or loose earth nearby to extinguish if it spreads. In dry conditions, clear a 2-meter circle of bare ground around the fire.

Wildfire — In dry, windy conditions, sparks travel. Build fires in sheltered locations. Never build fires under overhanging dry branches. If wind picks up, extinguish and wait.

Carbon monoxide — Never build fires in enclosed spaces without ventilation. CO is colorless and odorless. Symptoms: headache, dizziness, nausea. If you feel these near a fire in an enclosed space, leave immediately.

Eye injury — Sparks from flint and steel can hit eyes. Strike away from your face. Wear eye protection if available.

Blisters — Friction fire methods cause blisters on hands, especially the hand drill. Wrap palms with cloth or leather. Build calluses through practice over time, not through one desperate attempt.

Edition 1Stoutenburger AlmanacTurn ↻
1

Vuur maken

Voorzijde

RTW-005 Edition 1
Instructie I · Fist · Comb · Bread Basic Stap 1 van 8
Stap 1 — Prepare your tinder bundle

Prepare your tinder bundle

Gather two handfuls of the finest, driest material you can find. Shape it into a loose bird's-nest shape — dense enough to hold an ember, loose enough to allow airflow. This is the most important step. Wet tinder is the number one reason fire-making fails. If it bends without snapping, it is too wet.

Edition 1Stoutenburger AlmanacTurn ↻
1

Vuur maken

Achterzijde

RTW-005 Edition 1
Edition 1Stoutenburger AlmanacTurn ↻
2

Vuur maken

Voorzijde

RTW-005 Edition 1
Instructie I · Trail · Brook · Birch Basic Stap 2 van 8
Stap 2 — Prepare kindling and fuel

Prepare kindling and fuel

Gather a large armful of dry kindling (pencil-thick sticks) and a pile of fuel wood in increasing thicknesses. Sort by size. Have everything ready BEFORE you create your ember. Once you have fire, you need to feed it immediately and progressively.

Edition 1Stoutenburger AlmanacTurn ↻
2

Vuur maken

Achterzijde

RTW-005 Edition 1
Edition 1Stoutenburger AlmanacTurn ↻
3

Vuur maken

Voorzijde

RTW-005 Edition 1
Instructie I · Lamp · Bone · Hide Basic Stap 3 van 8
Stap 3 — Build your fire lay

Build your fire lay

Clear ground to bare earth or rock in a circle about 1 meter across. Place your tinder bundle in the center. Lean kindling sticks against each other in a teepee shape around and above the tinder, leaving a gap to insert your ember or flame. Do not pack kindling tightly — fire needs air.

Edition 1Stoutenburger AlmanacTurn ↻
3

Vuur maken

Achterzijde

RTW-005 Edition 1
Edition 1Stoutenburger AlmanacTurn ↻
4

Vuur maken

Voorzijde

RTW-005 Edition 1
Instructie I · Rust · Stone · Salt Basic Stap 4 van 8
Stap 4 — Method 1 — Bow drill (most reliable friction method)

Method 1 — Bow drill (most reliable friction method)

Carve a small depression near the edge of the fireboard, with a V-notch cut from the depression to the edge. Place a piece of bark or leaf under the notch to catch hot dust. Wrap the bowstring once around the spindle. Press the spindle into the fireboard depression using the handhold. Saw the bow back and forth with long, steady strokes. Increase speed and downward pressure as the notch fills with dark powder and begins to smoke. When the powder pile smokes on its own after you stop drilling, you have an ember.

Edition 1Stoutenburger AlmanacTurn ↻
4

Vuur maken

Achterzijde

RTW-005 Edition 1
Edition 1Stoutenburger AlmanacTurn ↻
5

Vuur maken

Voorzijde

RTW-005 Edition 1
Instructie I · Crow · Wolf · Copper Basic Stap 5 van 8
Stap 5 — Method 2 — Hand drill (simplest, most difficult)

Method 2 — Hand drill (simplest, most difficult)

Same fireboard and notch as the bow drill, but spin the spindle between your palms instead of using a bow. Press downward while spinning as fast as possible. Move your hands from the top of the spindle to the bottom, then quickly return to the top. This method requires considerable practice and endurance. It works best with very soft fireboards (mullein stalks, clematis, willow) and in dry conditions.

Edition 1Stoutenburger AlmanacTurn ↻
5

Vuur maken

Achterzijde

RTW-005 Edition 1
Edition 1Stoutenburger AlmanacTurn ↻
6

Vuur maken

Voorzijde

RTW-005 Edition 1
Instructie I · White · Birch · Eye Basic Stap 6 van 8
Stap 6 — Method 3 — Flint and steel

Method 3 — Flint and steel

Hold a sharp edge of flint, chert, or quartzite firmly. Strike the steel (a knife spine, a file, or a piece of high-carbon steel) against the sharp stone edge at an acute angle, directing sparks downward onto charcloth or very fine tinder. Alternatively, strike iron pyrite against flint — this was the method used before steel existed. Catch the spark, blow it gently into a glow.

Edition 1Stoutenburger AlmanacTurn ↻
6

Vuur maken

Achterzijde

RTW-005 Edition 1
Edition 1Stoutenburger AlmanacTurn ↻
7

Vuur maken

Voorzijde

RTW-005 Edition 1
Instructie I · Blue · Bread · Bear Basic Stap 7 van 8
Stap 7 — Transfer ember to tinder

Transfer ember to tinder

Gently tip the ember into the center of your tinder bundle. Fold the tinder loosely around it. Blow steadily and gently into the base of the bundle. The ember will glow brighter, then smoke will increase, then the tinder will ignite. Place the flaming bundle into your prepared fire lay. Add kindling progressively — smallest pieces first.

Edition 1Stoutenburger AlmanacTurn ↻
7

Vuur maken

Achterzijde

RTW-005 Edition 1
Edition 1Stoutenburger AlmanacTurn ↻
8

Vuur maken

Voorzijde

RTW-005 Edition 1
Instructie I · Moss · Eye · Blue Basic Stap 8 van 8
Stap 8 — Build up the fire

Build up the fire

Feed kindling from thin to thick. Do not smother the fire with large wood too early. Wait until each size is burning well before adding the next larger size. A fire that dies at this stage was fed too fast. Patience at this stage saves having to start over.

Edition 1Stoutenburger AlmanacTurn ↻
8

Vuur maken

Achterzijde

RTW-005 Edition 1
Edition 1Stoutenburger AlmanacTurn ↻

Vuur maken

Making Fire From What You Find

RTW-005 Edition 1
Instructie I · Field · Tin · Night Basic Controleer

Controleer

Ember test — The powder pile from friction methods smokes continuously on its own for at least 30 seconds after you stop drilling. If it stops smoking, it was not hot enough — continue drilling.

Tinder test — Tinder is dry if it snaps cleanly when bent. If it bends without breaking, it contains moisture and will not catch reliably.

Fire lay — Flames travel from kindling to kindling without gaps. If flames die between pieces, the kindling is too far apart or too thick.

Sustained fire — After 10 minutes, the fire burns without constant tending. Coals are forming at the base. You can add wrist-thick wood and it catches within a minute.

Het resultaat

A sustained, controllable fire suitable for cooking, water purification, warmth, and light.

Edition 1Stoutenburger AlmanacTurn ↻

Vuur maken

Achterzijde

RTW-005 Edition 1

Als het misgaat

Smoke but no ember — Increase downward pressure and speed in the final phase. The notch may need to be deeper or wider. The wood may be slightly damp — try different, drier wood.

Ember dies in tinder — Tinder was too wet, too tightly packed, or you blew too hard. Gentle, steady breath from below. The tinder bundle needs air channels.

Kindling does not catch — Kindling is too thick or too wet. Split pieces thinner. Use a knife to create fine shavings that curl from a stick (feather sticks).

Bow drill string slips — Wrap the string one more time around the spindle. The string needs tension — tighten the bow. If the string is too smooth, rough it up by dragging it through sand.

Spindle pops out — The handhold depression is too shallow. Carve it deeper. Apply more downward pressure. Keep the bow level and the spindle vertical.

Cannot find dry wood in rain — Look for dead standing wood (still attached to the tree but dead). The inside of dead standing wood is often dry even in rain. Split thick pieces to reach dry inner wood. Check under dense canopy, rock overhangs, and inside hollow logs.

Edition 1Stoutenburger AlmanacTurn ↻