Card Index

Every card carries a DNA code — a unique 64-character fingerprint written in A, C, G, and T. The first three groups form codon words (like Bell·Green·Hawk) for quick recognition. No two cards share the same code.

This first set starts from one question: what if we had to start over? From why knowledge disappears, to how to purify water and make fire — and the maker who wrote it all down.

Pick any card. Save it, print it, put it on a USB stick. Every card is a complete, self-contained document that works without the internet.

	Codon	Title	Set
N	Bear·Field·Rust.aaggctagtgaacgcaaagagacttcaaactaaacgctagcattgtggagcagtc	The Technology Tree	RTW-006
K	Bread·Grey·Wren.ggcgaacacaaataaacgtgtcacgtccctgaaacgctagcattgtggagcagtc	The Digital Library of Alexandria	RTW-002
P	Drum·Field·Black.tctaatgtaagtttagcccgctcttgagataaaacgctagcgcacgcaagaagta	Hand-Carved Wooden Mallet	RTW-008
K	Fog·Fire·Moon.atttagcttcacgaatctgcacgacgttgtaaaacgctacgggtttcaaacagcg	To the One Who Finds This	RTW-000
I	Hail·Salt·Fig.tgagtatttcgactccgaactcctgtttcgtaaacgctagcattgtggagcagtc	Purifying Water Without Electricity	RTW-004
I	Marsh·Ridge·Plum.tcgcagtggaaactccattttgtttcaggtcaaacgctagcattgtggagcagtc	Making Fire From What You Find	RTW-005
K	Moon·Copper·Birch.atggtgtgtaagacaaacgttagccacccccaaacgctagcattgtggagcagta	Why Knowledge Disappears	RTW-001
K	Oak·Deer·Lamp.atacactcccatcagttgctgaagtattataaaacgctagcattgtggagcagtc	What You Need to Start Over	RTW-003
M	Storm·Lamp·Marsh.tgattctagcccatggtcagggaggaaggacaaacgctagcattgtggagcagtc	Eo Ena	RTW-007

Start anywhere — or begin with To the One Who Finds This.

Print Verify Index

Cards in this network