Eo Ena — narrator
STOUTENBURGER ALMANACS.B.A.
Rebuilding The World — Edition 1
Network
N Bell·Green·Hawk RTW-009 Basic

Card Index

The complete catalog of Rebuilding The World — Edition 1. Nine cards — knowledge, instructions, and the people behind them. Each one built to survive without this website.

Read with…

Every card carries a DNA code — a unique 64-character fingerprint written in A, C, G, and T. The first three groups form codon words (like Bell·Green·Hawk) for quick recognition. No two cards share the same code.

This first set starts from one question: what if we had to start over? From why knowledge disappears, to how to purify water and make fire — and the maker who wrote it all down.

Pick any card. Save it, print it, put it on a USB stick. Every card is a complete, self-contained document that works without the internet.

CodonTitleSet
NBear·Field·Rust.aaggctagtgaacgcaaagagacttcaaactaaacgctagcattgtggagcagtcThe Technology TreeRTW-006
KBread·Grey·Wren.ggcgaacacaaataaacgtgtcacgtccctgaaacgctagcattgtggagcagtcThe Digital Library of AlexandriaRTW-002
PDrum·Field·Black.tctaatgtaagtttagcccgctcttgagataaaacgctagcgcacgcaagaagtaHand-Carved Wooden MalletRTW-008
KFog·Fire·Moon.atttagcttcacgaatctgcacgacgttgtaaaacgctacgggtttcaaacagcgTo the One Who Finds ThisRTW-000
IHail·Salt·Fig.tgagtatttcgactccgaactcctgtttcgtaaacgctagcattgtggagcagtcPurifying Water Without ElectricityRTW-004
IMarsh·Ridge·Plum.tcgcagtggaaactccattttgtttcaggtcaaacgctagcattgtggagcagtcMaking Fire From What You FindRTW-005
KMoon·Copper·Birch.atggtgtgtaagacaaacgttagccacccccaaacgctagcattgtggagcagtaWhy Knowledge DisappearsRTW-001
KOak·Deer·Lamp.atacactcccatcagttgctgaagtattataaaacgctagcattgtggagcagtcWhat You Need to Start OverRTW-003
MStorm·Lamp·Marsh.tgattctagcccatggtcagggaggaaggacaaacgctagcattgtggagcagtcEo EnaRTW-007

Start anywhere — or begin with To the One Who Finds This.